This is a shotgun library reaction of the German EHEC E. Not intended for any animal or human therapeutic or diagnostic use.ġ8 Accuracy A track record of continuous improvementĭec 2010: Ion Sequencing 314 Kit, PN Jul 2011: Ion Sequencing Kit, PN Jan 2012: Ion PGM™ 200 Sequencing Kit, PN May 2012: 300bp: 400bp: Nothing Gets Better Fasterġ9 High Data Quality May 2012 launch 4.6Mb EHEC E. Run RecognitION Torrent Browser Plugin Store Over 11,00 members Over 100 new members each week Source code Datasets Rank your runs against other users Win free chips for monthly best run Win $5k for new records Share your plugins with the community and earn points towards prizes Over 25 plugins currently available for FREE For Research Use Only. Virtual machines are available for use in development Penguin Computing: Amazon AMI: search “ion-torrent” or AMI-2c64c745 Download to run locallyġ5 Torrent Suite SDK Plugins are driven by shell scripts and html pagesĪPI Plugins / Publishers Plugin Store Plugins are driven by shell scripts and html pages #!/bin/bash OUTFILE=$.html echo "Hello World!" > $OUTFILE launch.shġ6 Ion Community Learn, Collaborate, Contribute Ion Community As we look forward to processing times on the Proton, these speed improvements coupled with more powerful processing hardware on both the Proton itself as well as a beefier Proton Torrent Server will mean that a Proton chip will be processed in hours rather than days. This graph illustrates the rapidly decreasing run times for a single 318 chip from the PGM system being processed on the Torrent Server (Dell T7500). Over the last nine months of software improvements, many enhancements in both signal processing and base calling have lead to faster and faster processing times. 12ġ3 Efficient data processing on Torrent ServerĤX faster Processing times for Proton 1 chips will be hours, not days. Incorporation for 1 Flow (DAT) Incorporation over many flows (DAT) Raw signals per flow (WELLS) Processed incorporations (SFF) Flow space converted to base space (FASTQ) GGGATCAGGCTGTCGAACGCGTGATTACATCTAGCTA + BAM Variant Call Format (VCF) #FORMAT=50 Ion Proton™ I Chip runs 8.5 in/21.8 cm ~120 lb/55 kg 26 in/64.6 cm 17 in/43 cm Processors Dual 8-core 2.9 GHz CPUs 128 GB RAM 2x NVIDIA® Tesla® GPUs 27 TB Ubuntu® 10.04 Memory GPUs 1 Torrent Server per Proton required (1:1 configuration) Storage OS The content provided herein may relate to products that have not been officially released and is subject to change without notice. Not intended for any animal or human therapeutic or diagnostic use.ħ Data Flows Directly to Ion Reporter Torrent Circuit and Desktop Solutions also Enable Other Research Applications Ion Reporter to support variant calling and annotation of tumor-normal pairs and mother-father-offspring trios The content provided herein may relate to products that have not been officially released and is subject to change without notice. Local compute and storage with an integrated web interface Torrent Server – hardware appliance Torrent Browser – easy web access to Ion data Plugins for secondary analysis e.g. Ion Torrent chips collect Protons Cross sectional view shows the Ion sensitive layer in green with the microwells on the top surface (3um) with the transistor stack underneath Wheras the image sensors collect photons. foundries) and are similar in design to CMOS image sensor chips found in iPhones and Blackberry’s. Chips are produced in std semiconductor factories (a.k.a. Ion Torrent chip manufacturing process leverages the cumulative investment in semiconductor manufacturing over the last 30 years. Scalable Semiconductor Technology Plus Simple Chemistry The chip that see chemistry Read clockwise from Wafer. Confidential and Proprietary-DO NOT DUPLICATEĮliminate source error: Modified bases Fluorescent bases Laser detection Eliminate read length limitations: Unnatural bases Protect/de-protect Slow cycle time H+ Sequence is determined by measuring hydrogen ions released (1 per base added per DNA strand) during 2nd strand synthesis when complementary base (A, C, G or T) are sequentially incorporated by DNA polymerase. Plus we’ll give another iPad away at the end of this talk. Gain the admiration of your Galaxy colleagues. Win 500 points on Ion Community (good towards an iPad), plus a iPod Nano. Confidential and Proprietary-DO NOT DUPLICATEīuild a Galaxy transfer plug-in. The future of genomics in medicine is dependent on Galaxy. But there’s a whole lot more discovery to undertake. Genomics will impact diagnostic medicine. How genomics software works… Algos get wrapped into workflows that kick out pretty pictures. Mike Lelivelt, Ph.D., Director of Bioinformatics The content provided herein may relate to products that have not been officially released and is subject to change without notice. Presentation on theme: "Ion Torrent: Open, Accessible, Enabling"- Presentation transcript:ġ Ion Torrent: Open, Accessible, Enabling
0 Comments
Leave a Reply. |